View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17761_high_67 (Length: 249)
Name: NF17761_high_67
Description: NF17761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17761_high_67 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 5313893 - 5314117
Alignment:
| Q |
1 |
aaagcctgttagaaaatcataaaaccatatatagacgagtttcaatgctttgtatccaatgcgtaaagctagattaaatcgcatttgtagtatcggttac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
5313893 |
aaagcctgttagaaaatcataaaaccatatatagatgagtttcaatgctttgtatccaatgcgtagagctagattaaatcgcatttgtagtatcagttac |
5313992 |
T |
 |
| Q |
101 |
aattgcatcacgatacaaaatatctgacgcagaaacataaaaacttgatgttgcataccatactgcggtcacaaatttattcattttcttaaatcttgaa |
200 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
5313993 |
aattgcatcacgatgcaaaatatctgatgcagaaacataaaaatttgatgttgcataccatactgcggtcacaaatttattcatttttttaaatcttga- |
5314091 |
T |
 |
| Q |
201 |
agtaacattaaatatggaaaataaattaa |
229 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
5314092 |
---aacattaaatatggaaaataaattaa |
5314117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University