View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17761_high_69 (Length: 244)
Name: NF17761_high_69
Description: NF17761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17761_high_69 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 16 - 229
Target Start/End: Original strand, 35350872 - 35351085
Alignment:
| Q |
16 |
gactcgtaatcgttattgtgttgccttgctagataactttgttttacatgtatggaaatatgacttagaggatgattatttggtaaaaggagtttatcac |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35350872 |
gactcgtaatcgttattgtgttgccttgctagataactttgttttacatgtatggaaatatgacttagaggatgattatttggtaaaaggagtttatcac |
35350971 |
T |
 |
| Q |
116 |
tccgtaaaaagagtttatcacttattgactcaatcagagtaacatattcttgctcatttcttggatattatttgaaacaaagttgtgccttttaaagatt |
215 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35350972 |
tccttaaaaagagtttatcacttattgactcaatcagagtaacatattcttgctcatttcttggatattatttgaaacaaagttgtgccttttaaagatt |
35351071 |
T |
 |
| Q |
216 |
tgttatttgtgtga |
229 |
Q |
| |
|
|||||||| ||||| |
|
|
| T |
35351072 |
tgttatttttgtga |
35351085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University