View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17761_low_2 (Length: 844)
Name: NF17761_low_2
Description: NF17761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17761_low_2 |
 | |
|
| [»] scaffold0016 (1 HSPs) |
| | |
|
| [»] scaffold0202 (1 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 79; Significance: 2e-36; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 79; E-Value: 2e-36
Query Start/End: Original strand, 387 - 481
Target Start/End: Original strand, 31093208 - 31093302
Alignment:
| Q |
387 |
ttaaaatgctttcccggaactggatgagatcaaaatcatcggggtcaggatatgcaatatcacattagtggactaaccctctagcttgtttagga |
481 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||| | |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31093208 |
ttaaaatgctttcccggaactggatgagatcaaaatcattgggatatggatatgcaatatcacattagtggactaaccctctagcttgtttagga |
31093302 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 69; E-Value: 2e-30
Query Start/End: Original strand, 661 - 795
Target Start/End: Complemental strand, 31074093 - 31073966
Alignment:
| Q |
661 |
ttttgtgcctagtgaaaaaatgtatgatggagtcccataacaccacttagttcatacagttttgtcatgtaatgtactatgacctaaataatttaaccac |
760 |
Q |
| |
|
||||||| ||||||| ||||||||||||||||||||||||||||||||||||| || ||||||| | |||||||||||| || ||||||||||||||| |
|
|
| T |
31074093 |
ttttgtgggtagtgaagtaatgtatgatggagtcccataacaccacttagttcattcaattttgtcttataatgtactatggccaaaataatttaaccac |
31073994 |
T |
|
| Q |
761 |
cctcttcccccttcatcatactttaaattattcca |
795 |
Q |
| |
|
||| ||||||||||||||||||||||||| |
|
|
| T |
31073993 |
cct-------cttcatcatactttaaattattcca |
31073966 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 203 - 333
Target Start/End: Complemental strand, 31034205 - 31034076
Alignment:
| Q |
203 |
tatagcataacaattgtagttctcatcttgttctttctcttgaataatccaaggtaagaaagatacaaaattgggtataagaatgatttgaattgcttgt |
302 |
Q |
| |
|
|||| |||| |||||||||||||||||| ||||||||| ||||| || |||||| |||||| ||| |||| | |||||||| |||||| |||||||| |
|
|
| T |
31034205 |
tataccatatcaattgtagttctcatctcattctttctccggaatagtctaaggtaggaaagagacagaatt-gatataagaacaatttgacttgcttgt |
31034107 |
T |
|
| Q |
303 |
ctatggtgtatttggaaggctaggaatgcga |
333 |
Q |
| |
|
|||||| || | ||||||| | |||||||| |
|
|
| T |
31034106 |
ctatggattaatgggaaggcaaagaatgcga |
31034076 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 64; Significance: 2e-27; HSPs: 1)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 64; E-Value: 2e-27
Query Start/End: Original strand, 203 - 482
Target Start/End: Original strand, 30798 - 31069
Alignment:
| Q |
203 |
tatagcataacaattgtagttctcatcttgttctttctcttgaataatccaaggtaagaaagatacaaaattgggtataagaatgatttgaattgcttgt |
302 |
Q |
| |
|
|||| |||| |||||||||||||||||| ||||||||| ||||| || |||||| |||||||||| |||| |||||||||| |||||| |||||||| |
|
|
| T |
30798 |
tataccatatcaattgtagttctcatctcattctttctccggaatagtctaaggtaggaaagatacataatt-ggtataagaacaatttgacttgcttgt |
30896 |
T |
|
| Q |
303 |
ctatggtgtatttggaaggctaggaatgcgagnnnnnnnntcacgatataagtgtttcgactgatactattttagaactgcattttaaaatgctttcccg |
402 |
Q |
| |
|
|||||| |||| ||||||||| |||||||| ||| |||| || ||||||||| |||||||||| |||| | || |||||||| | |
|
|
| T |
30897 |
ctatggattattgggaaggctaagaatgcga--aaaaaattcaggataaaaatgtttcgaccgatactatttcagaaaag-----gtaagtgctttcctg |
30989 |
T |
|
| Q |
403 |
gaactggatgagatcaaaatcatcggggtcaggatatgcaatatcacattagtggactaaccctctagcttgtttaggag |
482 |
Q |
| |
|
|||||||| || |||||||||||| ||| ||||||||||||||| | | |||||||||||||||| ||| |||||||| |
|
|
| T |
30990 |
aaactggataaggtcaaaatcatcgaggtttggatatgcaatatcaaagttgtggactaaccctctaccttttttaggag |
31069 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0202 (Bit Score: 61; Significance: 1e-25; HSPs: 1)
Name: scaffold0202
Description:
Target: scaffold0202; HSP #1
Raw Score: 61; E-Value: 1e-25
Query Start/End: Original strand, 298 - 482
Target Start/End: Original strand, 1856 - 2020
Alignment:
| Q |
298 |
cttgtctatggtgtatttggaaggctaggaatgcgagnnnnnnnntcacgatataagtgtttcgactgatactattttagaactgcattttaaaatgctt |
397 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| | ||||||||||| |
|
|
| T |
1856 |
cttgtctatagtgtatttggaaggctaggaatgcga--aaaaaattcacgatataagtgtttcgactgatactatttcagaacagg---ttaaaatgctt |
1950 |
T |
|
| Q |
398 |
tcccggaactggatgagatcaaaatcatcggggtcaggatatgcaatatcacattagtggactaaccctctagcttgtttaggag |
482 |
Q |
| |
|
||| ||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1951 |
tcctggaaccggatgagatct---------------ggatatgcaatatcacattagtggactaaccctctagcttgtttaggag |
2020 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University