View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17761_low_31 (Length: 383)
Name: NF17761_low_31
Description: NF17761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17761_low_31 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 339; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 339; E-Value: 0
Query Start/End: Original strand, 7 - 369
Target Start/End: Original strand, 28022620 - 28022982
Alignment:
| Q |
7 |
agaacctgtggtagaaatatcggtatcagaacttgtttttgatcttaaaagcaaaatcgaagacgagttggaggtgggagtacacaggcaaaatctctgg |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28022620 |
agaacctgtggtagaaatatcggtatcagaacttgtttttgatcttaaaagcaaaatcgaaaacgagttggaggtgggagtacacaggcaaaatctctgg |
28022719 |
T |
 |
| Q |
107 |
tacaagggtatagagttggataacgagaaaaggattggattctatgctttgtgcggagatgaaacagaaacagttactctcattgttgatccactgccat |
206 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
28022720 |
tacaagggtatagagttggataatgagaaaaggattggattctatgctttgcgcggagatgaaacagaaacagttactctcattgttgatccgctgccat |
28022819 |
T |
 |
| Q |
207 |
cagacctgaaactacatgttttagtgaagtttcttggccatggcagcaatggctatgtgagggtgaaggagaccgataaggtgagtgacctgtgcgacaa |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
28022820 |
cagacctgaaactacatgttttagtgaagtttcttggccatggcagcaatggctatgtgagggtgaaggagaccgataaggtgagtgacctgtgcaacaa |
28022919 |
T |
 |
| Q |
307 |
agtttcacgatattggggcattccccttgatactttcacccttcatcgtctcaatgttgaaat |
369 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28022920 |
agtttcacggtattggggcattccccttgatactttcacccttcatcgtctcaatgttgaaat |
28022982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University