View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17761_low_34 (Length: 376)
Name: NF17761_low_34
Description: NF17761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17761_low_34 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 314; Significance: 1e-177; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 314; E-Value: 1e-177
Query Start/End: Original strand, 22 - 374
Target Start/End: Original strand, 27540415 - 27540767
Alignment:
| Q |
22 |
aaagattgaagagcaaacgtttt-ttaacgatgttgttgtaatcttgatctttggaaatcgaaggggttccaccatgattcattagacccgcaagacaat |
120 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27540415 |
aaagattgaagagcaaatgtttttttaacgatgttgttgtaatcttgatctttggaaaccgaaggggttccaccatgattcattagacccgcaagacaat |
27540514 |
T |
 |
| Q |
121 |
ggttgcggatgtctcactgaaaatggaattgttgcagtatctacatcgcgcagtttactatcttggccttatcaatttaattaatggcctgagattgttg |
220 |
Q |
| |
|
||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27540515 |
ggttgtggatgtctcactgaaaatggaactgttgcagtatctacatcgcgcagtttacgatcttggccttatcaatttaattaatggcctgagattgttg |
27540614 |
T |
 |
| Q |
221 |
aaaactagtattgttagtgtaatcttagtcgtctaatctcgtattaatggttgaaattgtttactgcgtgtaaatatgtgcttctcctgtaactgggaac |
320 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
27540615 |
aaaactagtattgttagtgtaatcttagtcgtctaatctcgtattaatggttgaaattgtttactgtgtgtaaatatgtgcttctcctgtaactgggaac |
27540714 |
T |
 |
| Q |
321 |
ccggagccatgtctcactccattttttagaactaaattgggtactcgagttgtt |
374 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
27540715 |
ccggagccatgtctcactccattttttagaact-aattgggtactcgagttgtt |
27540767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University