View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17761_low_39 (Length: 364)
Name: NF17761_low_39
Description: NF17761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17761_low_39 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 143; Significance: 5e-75; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 143; E-Value: 5e-75
Query Start/End: Original strand, 161 - 364
Target Start/End: Original strand, 2938998 - 2939215
Alignment:
| Q |
161 |
gccttagcttacacttgcgtgcagttttgtacacattcgtctggtcaattatataattgcgaggtacattagccaccatgggcaaaattagtttgaacat |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
2938998 |
gccttagcttacacttgcgtgcagttttgtacacattcgtctggtcaattatataattgtgaggtacattagccaccatgggcaaaattactttgaacat |
2939097 |
T |
|
| Q |
261 |
--------------tctatcaaacgacgaaacctttcattgtagttgtttttctgcaacagtccaggaacctaaataacactaggttaagcaaaaactat |
346 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
2939098 |
ttcatttgccttagtctatcaaacgacgaaacctttcattgtagttgtttttctgcaacagtccgcgaacctaaataacaataggttaagcaaaaactat |
2939197 |
T |
|
| Q |
347 |
tgatggaaaaatgataac |
364 |
Q |
| |
|
|| | ||||||||||||| |
|
|
| T |
2939198 |
tgttagaaaaatgataac |
2939215 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 1 - 70
Target Start/End: Original strand, 2938245 - 2938314
Alignment:
| Q |
1 |
aaccagcattccctccaggaaaatgagatgctttgttgttggaataaagtccacgaggagagggtgacct |
70 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
2938245 |
aaccagcattccctccaggaaaatgagatgcttcgttgttggaataaagtccacgaggagagggtgacct |
2938314 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University