View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17761_low_48 (Length: 325)
Name: NF17761_low_48
Description: NF17761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17761_low_48 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 2 - 311
Target Start/End: Original strand, 27540771 - 27541082
Alignment:
| Q |
2 |
gcataggtcacattggtttcgacgcatatttttgaacatctatttttgttgataaatttaacatctattttcttatgttaataaactgaggtgtttt--t |
99 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
27540771 |
gcatgggtcacattggttttgacgcatatttttgaacatctatttttgttgataaatttaacatctattttcttatgttaataaactgaggtgttttttt |
27540870 |
T |
 |
| Q |
100 |
atttatcacaatttttatgttgtaaattatcagatcattttatttctttagcactaaagaaagtatgcttcacattcatgcaatgaactggatatcttga |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
27540871 |
atttatcacaatttttatgttgtaaattatcagatcattttatttctttagcactaaagaaagtatgcttcgcattcatgcaatgaactggatatcttga |
27540970 |
T |
 |
| Q |
200 |
tcatcagcagtagtactttggtcatattttagatgtataacagctatttttaggaagaaatgtgtcatttaaccacatcttaagcaatttattttattat |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27540971 |
tcatcagcagtagtactttggtcatattttagatgtataacagctatttttaggaagaaatgtgtcatttaaccacatcttaagcaatttattttattat |
27541070 |
T |
 |
| Q |
300 |
tgatgtagatat |
311 |
Q |
| |
|
|||||||||||| |
|
|
| T |
27541071 |
tgatgtagatat |
27541082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University