View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17761_low_52 (Length: 307)
Name: NF17761_low_52
Description: NF17761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17761_low_52 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 16 - 152
Target Start/End: Original strand, 41864488 - 41864624
Alignment:
| Q |
16 |
agaagaattatcacaaaagctacaataaactaatgtaaaacatgtaaggagaaaattcttgagaaaacaaaacaaaccgatgcaaagagaaagcacacag |
115 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
41864488 |
agaagaattatcacaaaagctacaatgaactaatgtaaaacatgtaaggagaaaattcttgagaaaacaaaacaaaccgatacaaacagaaagcacacag |
41864587 |
T |
 |
| Q |
116 |
atatgaagagttaacattcatacgaagggttctttat |
152 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41864588 |
atatgaagagttaacattcatacgaagggttctttat |
41864624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 191 - 305
Target Start/End: Original strand, 41864690 - 41864804
Alignment:
| Q |
191 |
ctcaataaatgaactcaactatattgcttccaaaaggggatggttcaagttggtggctccaagcttgtgtttcttcgtaaacaaattattcaaacccact |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||| || |
|
|
| T |
41864690 |
ctcaataaatgaactcaactatattgcttccaaaaggggatggttcaagttggtggttccaagcttgtgtttcttcgtaaacaaattattcagcccctct |
41864789 |
T |
 |
| Q |
291 |
cttttctgtgctcct |
305 |
Q |
| |
|
||||| ||||||||| |
|
|
| T |
41864790 |
cttttttgtgctcct |
41864804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University