View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17761_low_56 (Length: 298)
Name: NF17761_low_56
Description: NF17761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17761_low_56 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 13 - 212
Target Start/End: Complemental strand, 33117402 - 33117205
Alignment:
| Q |
13 |
taatactcaagtatagtaaacaccaagcaagaatccttgccatcattgtgaatgagcgtgaataaagaatattgaaaacaaaaagacaaaacgattagat |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33117402 |
taatactcaagtatagtaaacaccaagcaagaatccttgccatcattgtgaat----------aaagaatattgaaaacaaaaagacaaaacgattagat |
33117313 |
T |
|
| Q |
113 |
atttgagatgtgaaacagtgaaagctctaatttaccaaatgttgagtagtataattttatattcaca--------attcattccacttattttttaagct |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
33117312 |
atttgagatgtgaaacagtgaaagctctaatttaccaaatgttgagtagcataattttatattcacaatgtggatattcattccacttattttttaagct |
33117213 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 250 - 286
Target Start/End: Complemental strand, 33117167 - 33117131
Alignment:
| Q |
250 |
cattattaatgcagatcctaagaaaatagtcataaac |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33117167 |
cattattaatgcagatcctaagaaaatagtcataaac |
33117131 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University