View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17761_low_58 (Length: 287)
Name: NF17761_low_58
Description: NF17761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17761_low_58 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 203; Significance: 1e-111; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 50 - 271
Target Start/End: Original strand, 199134 - 199358
Alignment:
| Q |
50 |
tttacagcattatatcctcaaagttaaagagttatacaaatgaaacttactatctctttggtgtgatcaggagggggtagtatggctttcataaaatgct |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
199134 |
tttacagcattatatcctcaaagttaaagagttatacaaatgaaacttactatctctttggtgtgatcaggagggggtagtatggctttcataaaatgct |
199233 |
T |
|
| Q |
150 |
tggatgctttctccggcgccggtgaccggccacatcttctccggtgagactgcattgtgttgtttgttgcaatgcaaataataatgataagttttacgtt |
249 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
199234 |
tcgatgctttctccggcgccggtgaccggccacatcttctccggtgaggctgcattgtgttgtttgttgcaatgcaaataataatgataagttttacgtt |
199333 |
T |
|
| Q |
250 |
a---tgctgcatttagtttagtagt |
271 |
Q |
| |
|
| ||||||||||||||||||||| |
|
|
| T |
199334 |
atgctgctgcatttagtttagtagt |
199358 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 198809 - 198856
Alignment:
| Q |
1 |
tagatgaagcataaaggtataaaacaaggtaatacacacagtttatta |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
198809 |
tagatgaagcataaaggtataaaacaaggtaatacacacagtttatta |
198856 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 97 - 170
Target Start/End: Original strand, 212281 - 212354
Alignment:
| Q |
97 |
tactatctctttggtgtgatcaggagggggtagtatggctttcataaaatgcttggatgctttctccggcgccg |
170 |
Q |
| |
|
|||||||||||| || ||||||||||| || ||||||||||||||||||||||| || ||||||||| ||||| |
|
|
| T |
212281 |
tactatctcttttgtatgatcaggaggaggaagtatggctttcataaaatgctttgaatctttctccgccgccg |
212354 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 131 - 207
Target Start/End: Original strand, 223583 - 223659
Alignment:
| Q |
131 |
atggctttcataaaatgcttggatgctttctccggcgccggtgaccggccacatcttctccggtgagactgcattgt |
207 |
Q |
| |
|
||||||||||||||||| || || |||||||||||||||||| |||| || | ||||||||| ||| ||||||||| |
|
|
| T |
223583 |
atggctttcataaaatgtttagaatctttctccggcgccggtggccggacagagcttctccggcgagcctgcattgt |
223659 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University