View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17761_low_60 (Length: 283)
Name: NF17761_low_60
Description: NF17761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17761_low_60 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 5 - 264
Target Start/End: Original strand, 7887833 - 7888092
Alignment:
| Q |
5 |
atttccacgtaacttcctctttggaactgcatcttcttcctatcaggttattttagctagcaaacttatcttatcgagtgaatattgatactcaaaattg |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7887833 |
atttccacgtaacttcctctttggaactgcatcttcttcctatcaggttattttagctagcaaacttatcttatcgagtgaatattgatactcaaaattg |
7887932 |
T |
 |
| Q |
105 |
tagagtttgaataattcgatcttttaattttatggaacgataaatcaatctttaatttaaatttaaagttttcaatcaatttaaagttggaataggtgag |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7887933 |
tagagtttgaataattcgatcttttaattttatggaacgataaatcaatctttaatttaaatttaaagttttcaatcaatttaaagttggaataggtgag |
7888032 |
T |
 |
| Q |
205 |
agttcgcacgttgattaggactttcattggtatctattttataattgaaaattgattgat |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7888033 |
agttcgcacgttgattaggactttcattggtatctattttataattgaaaattgattgat |
7888092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University