View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17761_low_65 (Length: 264)
Name: NF17761_low_65
Description: NF17761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17761_low_65 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 99 - 249
Target Start/End: Original strand, 2581897 - 2582047
Alignment:
| Q |
99 |
gttatttgttcaaattacctgcagcacttaaccatgtttgaagatcatcaaaaacttgatgaaatgaagaattttcccttgaagcagtcaatgtgttatt |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
2581897 |
gttatttgttcaaattacctgcagcacttaaccatgtttgaagatcatcaaaaacttgatgaagtgaagaattttcccttgaagcagtcaatgtgttatt |
2581996 |
T |
 |
| Q |
199 |
caaatgatcaatagcaagatccaaaaggaccctacaatttttcaaagcttc |
249 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2581997 |
caaatgatcaatagcaagatccaaaagaaccctacaatttttcaaagcttc |
2582047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University