View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17761_low_66 (Length: 261)
Name: NF17761_low_66
Description: NF17761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17761_low_66 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 3 - 244
Target Start/End: Complemental strand, 3617049 - 3616805
Alignment:
| Q |
3 |
tgtaaaaacaaccgttaacgaaaatgtcnnnnnnn-aattatacggatttataagctataaatcttaagttcaaatttatgtcaaacgtagtttgactct |
101 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||| |
|
|
| T |
3617049 |
tgtaaaaacaaccgttaacgaaaatgtcttttttttaattatacggatttataagctataaatcataagtttaaatttatgtcaaacgtagtttgactct |
3616950 |
T |
 |
| Q |
102 |
ctgcctctctct--taatctcactccccctattaacaaagaaaaatataatcaggatgaatgattactagaaaaaatgaatgataaaaggagagaatcat |
199 |
Q |
| |
|
| |||||||||| ||||||||||||||||||||||||||||||||| |||||||| ||| |||||||||| ||||||||||||||||| | |||||||| |
|
|
| T |
3616949 |
ccgcctctctctcttaatctcactccccctattaacaaagaaaaatacaatcaggaagaaggattactagagaaaatgaatgataaaagaaaagaatcat |
3616850 |
T |
 |
| Q |
200 |
ctgattatctctctcttcatagcctaagagacaaacacacaaata |
244 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3616849 |
ctgattatctctctcttcatagtctaagagacaaacacacaaata |
3616805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University