View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17761_low_81 (Length: 223)
Name: NF17761_low_81
Description: NF17761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17761_low_81 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-110; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 205
Target Start/End: Original strand, 38744244 - 38744448
Alignment:
| Q |
1 |
tgtagaatattctgtcattcaaatgaaaagagaagtagggtacaaaagatgactcaagtgtgttggaggttttctgttgtgtcttattgagtaaactcta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38744244 |
tgtagaatattctgtcattcaaatgaaaagagaagtagggtacaaaagatgactcaagtgtgttggaggttttctgttgtgtcttattgagtaaactcta |
38744343 |
T |
|
| Q |
101 |
gtgccatatttgtgtagagcaacagcaacggacaggtgaatttgtggcattatctatatgccacttgaacattttattattgtatataataattctggta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
38744344 |
gtgccatatttgtgtagagcaacagcaacggacaggtgaatttgtggcattatctatatgccacttgaacattttattattgtatataataattctggaa |
38744443 |
T |
|
| Q |
201 |
gcctg |
205 |
Q |
| |
|
||||| |
|
|
| T |
38744444 |
gcctg |
38744448 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 39 - 146
Target Start/End: Original strand, 38740395 - 38740502
Alignment:
| Q |
39 |
ggtacaaaagatgactcaagtgtgttggaggttttctgttgtgtcttattgagtaaactctagtgccatatttgtgtagagcaacagcaacggacaggtg |
138 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||||||||||| |||||||| ||||||||||||| |||| | ||| || ||||||||||||| |
|
|
| T |
38740395 |
ggtacaaaagatgactcaaatttgttggaggttttctgttgtgtcctattgagtgaactctagtgccacatttatataggtcatgagcaacggacagggt |
38740494 |
T |
|
| Q |
139 |
aatttgtg |
146 |
Q |
| |
|
|||||||| |
|
|
| T |
38740495 |
aatttgtg |
38740502 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University