View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17761_low_82 (Length: 223)
Name: NF17761_low_82
Description: NF17761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17761_low_82 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 206; Significance: 1e-113; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 210
Target Start/End: Complemental strand, 5680238 - 5680029
Alignment:
| Q |
1 |
gacatgttgtggaaatgatgatgttcattgccataggtgtagacaaaacgcaatttgatataatgtgatgatatttataaagggttaaaggttaattaca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5680238 |
gacatgttgtggaaatgatgatgttcattgccataggtgtagacaaaacgcaatttgatgtaatgtgatgatatttataaagggttaaaggttaattaca |
5680139 |
T |
|
| Q |
101 |
cgaatctctaaccaatgtttaccctcatctcaagaatatgtctcttatctgattaaacgacaaaattttataggcatgctattggacatgtctttctgta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5680138 |
cgaatctctaaccaatgtttaccctcatctcaagaatatgtctcttatctgattaaacgacaaaattttataggcatgctattggacatgtctttctgta |
5680039 |
T |
|
| Q |
201 |
tattggacat |
210 |
Q |
| |
|
|||||||||| |
|
|
| T |
5680038 |
tattggacat |
5680029 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 165 - 201
Target Start/End: Complemental strand, 5689496 - 5689460
Alignment:
| Q |
165 |
attttataggcatgctattggacatgtctttctgtat |
201 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||||| |
|
|
| T |
5689496 |
attttataggcatgctattggataggtctttctgtat |
5689460 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University