View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17761_low_84 (Length: 210)
Name: NF17761_low_84
Description: NF17761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17761_low_84 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 117; Significance: 9e-60; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 81 - 201
Target Start/End: Complemental strand, 31025846 - 31025726
Alignment:
| Q |
81 |
caaactactataaaatttcagacatgaatatctaggtcaatttttcttattaaccccaatatgtctctatgcatggttttgtatatataatttaagcatt |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31025846 |
caaactactataaaatttcagacatgaatatctaggtcaatttttcttattaaccccaatatgtctctatgcatggttttgtatatataatttaagcatt |
31025747 |
T |
 |
| Q |
181 |
agttgtttatcctttgctact |
201 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
31025746 |
agttgtttatcctttggtact |
31025726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University