View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17762_low_8 (Length: 252)
Name: NF17762_low_8
Description: NF17762
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17762_low_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 247
Target Start/End: Complemental strand, 1708633 - 1708390
Alignment:
| Q |
1 |
tcatcatcgtacccatgaattgctcttgttcttcttcttcaactatgatcctcttcgattcacgcccatgtttcaaattcaaaaaaccatttctcatcaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1708633 |
tcatcatcgtacccatgaattgctcttgttcttcttc---aactatgatcctcttcgattcacgcccatgtttcaaattcaaaaaaccatttctcatcaa |
1708537 |
T |
|
| Q |
101 |
tccttcaccctccttcggaattcaaatcaaacccagcttcaaattcaataaagatcattatagacaaagctactgcaaggcagtgttcgtcgatgatgct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1708536 |
tccttcaccctccttcggaattcaaatcaaacccagcttcaaattcaataaagatcattatagacaaagctactgcaaggcagtgttcgtcgatgatgct |
1708437 |
T |
|
| Q |
201 |
ccgttcgccgccgcaatcggtgcttgcatgctcactcctttgcttct |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
1708436 |
ccgttcgccgccgcaatcggtgcttgcatgctcacttctttgattct |
1708390 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 58; Significance: 2e-24; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 162 - 247
Target Start/End: Complemental strand, 36175920 - 36175835
Alignment:
| Q |
162 |
agacaaagctactgcaaggcagtgttcgtcgatgatgctccgttcgccgccgcaatcggtgcttgcatgctcactcctttgcttct |
247 |
Q |
| |
|
||||||| || ||||||||||||||||| |||||||||||||||||| ||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
36175920 |
agacaaaactcctgcaaggcagtgttcgccgatgatgctccgttcgcggccgcaatcggagcttgcatgctcacttttttgcttct |
36175835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 2 - 129
Target Start/End: Complemental strand, 36176052 - 36175922
Alignment:
| Q |
2 |
catcatcgtacccatgaattgctcttgttcttcttcttcaactatgatcctcttcgattcacgcccatgtttcaaattcaaa---aaaccatttctcatc |
98 |
Q |
| |
|
||||||||||||||||||| | | ||||| ||||||||| |||||||||||||| ||||||| ||| | ||||||||||||| |||| |||| |||| |
|
|
| T |
36176052 |
catcatcgtacccatgaatcgttgttgttgttcttcttctactatgatcctcttagattcacacccttatttcaaattcaaattcaaacaatttatcata |
36175953 |
T |
|
| Q |
99 |
aatccttcaccctccttcggaattcaaatca |
129 |
Q |
| |
|
||| || ||||||| |||||||||||||||| |
|
|
| T |
36175952 |
aattctccaccctcattcggaattcaaatca |
36175922 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University