View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17763_high_102 (Length: 276)
Name: NF17763_high_102
Description: NF17763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17763_high_102 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 14 - 260
Target Start/End: Complemental strand, 7544202 - 7543956
Alignment:
| Q |
14 |
aggcacatatgatgagtcacggtgtttggaaggtaaacaaggtgaaacctttcctcgtatcaggataattggccaataaaaattgccgacataagaaata |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
7544202 |
aggcacatatgatgagtcacggtgtttggaaggtaaacaaggtgaaacctttcctcgtatcaggataattggtcaataaaaattgccgacataagaaata |
7544103 |
T |
|
| Q |
114 |
acgcaaaaggtgtcgctttgaagaatcttgaaagttaagagattcatggaaccaaacaagaccaattttccgtttgatgtttagcacataatgaacgggt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7544102 |
acgcaaaaggtgtcgctttgaagaatcttgaaagttaagagattcatggaaccaaacaagaccaattttccgtttgatgtttagcacataatgaacgggt |
7544003 |
T |
|
| Q |
214 |
tctttgctcacatcaaaacatctcgccatgtgtagagaccgccttga |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7544002 |
tctttgctcacatcaaaacatctcgccatgtgtagagaccgccttga |
7543956 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University