View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17763_high_111 (Length: 266)
Name: NF17763_high_111
Description: NF17763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17763_high_111 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 14 - 254
Target Start/End: Original strand, 39059768 - 39060008
Alignment:
| Q |
14 |
agtttgaacttcgacacttatatgttattatctctacaagctatacgagactcatcttaatctcttttaatcaacttcaactattaaccaatcaaccatg |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39059768 |
agtttgaacttcgacacttatatgttattatctctacaagctacacgagactcatcttactctcttttaatcaacttcaactattaaccaatcaaccatg |
39059867 |
T |
 |
| Q |
114 |
gcaagatcaaattcatatcaattttgagtgaatccatttcgttgcttactttttaattgatactcataggacattcaatattaaagctagtatcaatcaa |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
39059868 |
gcaagatcaaattcatatcaattttgagtgaatccatttcgttgcttattttttaattgatactcataggacactcaatattaaagctagtatcaatcaa |
39059967 |
T |
 |
| Q |
214 |
ttagtatattgcgaatattttcttacacgttcacttttttc |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39059968 |
ttagtatattgcgaatattttcttacacgttcacttttttc |
39060008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University