View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17763_high_133 (Length: 245)
Name: NF17763_high_133
Description: NF17763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17763_high_133 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 17 - 224
Target Start/End: Original strand, 42313556 - 42313763
Alignment:
| Q |
17 |
cagagacaaggagagtctcatacttaatagagagatgtgcggagtattctccataccaataaaatccgggctatatttcacatccaaccataattctttc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42313556 |
cagagacaaggagagtctcatacttaatagagagatgtgcggagtattctccataccaataaaatccgggctatatttcacatccaaccataattctttc |
42313655 |
T |
|
| Q |
117 |
taactgttccacaagcaggaagctaattggagcaagagctttctacaaaggttatgaggcatatgtaggcaaacttgatgcatcattttacactgcacgt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42313656 |
taactgttccacaagcaggaagctaattggagcaagagctttctacaaaggttatgaggcatatgtaggcaaacttgatgcatcattttacactgcacgt |
42313755 |
T |
|
| Q |
217 |
gacacaat |
224 |
Q |
| |
|
|||||||| |
|
|
| T |
42313756 |
gacacaat |
42313763 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University