View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17763_high_136 (Length: 240)
Name: NF17763_high_136
Description: NF17763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17763_high_136 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 5 - 208
Target Start/End: Original strand, 21930309 - 21930512
Alignment:
| Q |
5 |
gagagagatgaaagtgatgtataaatagagggacagagagaaagaaacagtaaagtaatgtaaaggatgagacaaaaaggaaagagagattacaagggtt |
104 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21930309 |
gagagggatgaaagtgatgtataaatagagggacagagagaaagaaacagtaaagtaatgtaaaggatgagacaaaaaggaaagagagattacaagggtt |
21930408 |
T |
 |
| Q |
105 |
agggtattgtggtgaattagataggtnnnnnnngtactatgtctcttatgttgatgttccttttagaggagcattcaagtagggtttaacagtacttcat |
204 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21930409 |
agggtattgtggtgaattagataggtaaaaaaagtactatgtctcttatgttgatgttccttttagaggagcattcaagtagggtttaacagtacttcat |
21930508 |
T |
 |
| Q |
205 |
gcac |
208 |
Q |
| |
|
|||| |
|
|
| T |
21930509 |
gcac |
21930512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 156 - 184
Target Start/End: Complemental strand, 43168945 - 43168917
Alignment:
| Q |
156 |
tgatgttccttttagaggagcattcaagt |
184 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
43168945 |
tgatgttccttttagaggagcattcaagt |
43168917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University