View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17763_high_56 (Length: 387)
Name: NF17763_high_56
Description: NF17763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17763_high_56 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 128; Significance: 4e-66; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 128; E-Value: 4e-66
Query Start/End: Original strand, 34 - 202
Target Start/End: Complemental strand, 44594887 - 44594719
Alignment:
| Q |
34 |
tcagaaactaaggttggtgaggaaaccaagcaaagcatcaaaattacataacatagtaataattaacaaaaaggcatcaaagcaagtaaacaatcttcca |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
44594887 |
tcagaaactaaggttggtgaggaaaccaagcaaaccatcaaaattacataacatagtaataattaacaaaaaggcatcaaagcaagtaaacaatcttcta |
44594788 |
T |
|
| Q |
134 |
atataaacccaacatagtccatttttctcatagnnnnnnntctaagagagaaagaaacatagccactag |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
44594787 |
atataaacccaacatagtccatttttctcatagaaaaaaaatcaagagagaaagaaacatagccactag |
44594719 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 96; E-Value: 6e-47
Query Start/End: Original strand, 261 - 370
Target Start/End: Complemental strand, 44594658 - 44594552
Alignment:
| Q |
261 |
cctttgaaactttgtattgagtctcatcttgttattgccttcttttgatcggagtaatgggcataccctgccgttgttcccacacctcccaatcccacat |
360 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44594658 |
cctttgaaactttgtattgagtctcatcttgtt---gccttcttttgatcggagtaatgggcataccctgccgttgttcccacacctcccaatcccacat |
44594562 |
T |
|
| Q |
361 |
cactgaaatc |
370 |
Q |
| |
|
|||||||||| |
|
|
| T |
44594561 |
cactgaaatc |
44594552 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University