View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17763_high_69 (Length: 352)
Name: NF17763_high_69
Description: NF17763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17763_high_69 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 285; Significance: 1e-160; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 285; E-Value: 1e-160
Query Start/End: Original strand, 1 - 343
Target Start/End: Original strand, 4142179 - 4142523
Alignment:
| Q |
1 |
acattacgttttctttaatctctgttactagttgtcgttctaactcatagaaattctaa-----atatgannnnnnngatgaaggttctaagtgatccac |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||| ||||||||||||||||||||||| |
|
|
| T |
4142179 |
acattacgttttctttaatctctgttactagttgtcgttctaactcatagaaattctgatctgaatatgatttatttgatgaaggttctaagtgatccac |
4142278 |
T |
 |
| Q |
96 |
aaaagaaagcaatttatgatcaatatggagaagaaggacttaaagggcaagtaccaccacggcctcaagatgctacattcttccaaagtggagatgggcc |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4142279 |
aaaagaaagcaatttatgatcaatatggagaagaaggacttaaagggcaagtaccaccac---ctcaagatgctacattcttccaaagtggagatgggcc |
4142375 |
T |
 |
| Q |
196 |
aacaacgtttaggttcaatccaagaaacgcaaacgatatctttgcagagtttttcgggttttcaagtccgtttggaggaatgggagctggtgggaatgga |
295 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4142376 |
aacaacgtttaggttcaatccaagaaatgcaaacgatatctttgcagagtttttcgggttttcaagtccgtttggaggaatgggagctggtgggaatgga |
4142475 |
T |
 |
| Q |
296 |
atgagaggtggagcaaggtcctttggtggaatgtttggtggtgatgat |
343 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4142476 |
atgagaggtggagcaaggtcctttggtggaatgtttggtggtgatgat |
4142523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 74 - 127
Target Start/End: Original strand, 4146504 - 4146557
Alignment:
| Q |
74 |
atgaaggttctaagtgatccacaaaagaaagcaatttatgatcaatatggagaa |
127 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||||||||||||||| ||||||||| |
|
|
| T |
4146504 |
atgaaggttctaagtgatccgcaaaagagagcaatttatgatcagtatggagaa |
4146557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 96 - 132
Target Start/End: Original strand, 30480538 - 30480574
Alignment:
| Q |
96 |
aaaagaaagcaatttatgatcaatatggagaagaagg |
132 |
Q |
| |
|
||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
30480538 |
aaaagaaagcaatctatgatcaatatggggaagaagg |
30480574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University