View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17763_high_89 (Length: 298)
Name: NF17763_high_89
Description: NF17763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17763_high_89 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 263; Significance: 1e-147; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 263; E-Value: 1e-147
Query Start/End: Original strand, 14 - 280
Target Start/End: Complemental strand, 55308472 - 55308206
Alignment:
| Q |
14 |
ttctttacctggctactatgtgtttactgaaggcttcctgtaaagactcttcaattagagcaaacagcagtgatgggtgaagctgagacaccgtcagttg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
55308472 |
ttctttacctggctactatgtgtttactgaaggcttcctgtaaagactcttcaattagagcaaacagcagtgatgggtgaagctgagacaccgtcaattg |
55308373 |
T |
|
| Q |
114 |
ttgctggccgaatgcgattagtctttagcacacttgaggtcagtaatttacattttgtagtcactatgatatttagaaaacttatttgcataacaatggt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55308372 |
ttgctggccgaatgcgattagtctttagcacacttgaggtcagtaatttacattttgtagtcactatgatatttagaaaacttatttgcataacaatggt |
55308273 |
T |
|
| Q |
214 |
taccatatgtctatacacttaccagatatgataataaacttgaattcgatgttgcaggtagtaagtc |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55308272 |
taccatatgtctatacacttaccagatatgataataaacttgaattcgatgttgcaggtagtaagtc |
55308206 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University