View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17763_high_92 (Length: 290)
Name: NF17763_high_92
Description: NF17763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17763_high_92 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 36 - 290
Target Start/End: Original strand, 39926478 - 39926732
Alignment:
| Q |
36 |
tgaattgtgaacttttctcatcttaaaaaacatggatgtggtgtacactaagaccctgagccatgggaagctgaagttgtaccataaagtcagttacatt |
135 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
39926478 |
tgaattgtaaacttttctcatcttaaaaaacatggatgtggtgtacactaagaccctgagccatgggaagctgaagttgtaccataaagacagttacatt |
39926577 |
T |
|
| Q |
136 |
acatcagtacttctctgctgatgttgtaatgcaatttatgggctgagtaagacttccaaaggaaaaggtaagatttctcattaatttcatctaaattatc |
235 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39926578 |
gcatcagtacttctatgctgatgttgtaatgcaatttatgggctgagtaagacttccaaaggaaaaggtaagatttctcattaatttcatctaaattatc |
39926677 |
T |
|
| Q |
236 |
taccctcttttcaaaaagatcaataaaggttaatagaattttacatcttaaggct |
290 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39926678 |
taccctcttttcaaaaatatcaataaaggttaatagaattttacatcttaaggct |
39926732 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University