View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17763_high_99 (Length: 279)
Name: NF17763_high_99
Description: NF17763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17763_high_99 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 176; Significance: 7e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 176; E-Value: 7e-95
Query Start/End: Original strand, 1 - 200
Target Start/End: Original strand, 36056147 - 36056346
Alignment:
| Q |
1 |
gatttgctttgggatgttcatagttggttttttaaacctgtttctgggtttgcagtgtttatgtttaggactaggagtggtttggatagtagattatggt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
36056147 |
gatttgctttgggatgttcatagttggttttttaaacctgtttctgggtttgcagtgtttatgtttaggactaggagtggtttggatagtagattgtggt |
36056246 |
T |
 |
| Q |
101 |
tagaagataatttagtactgaaagataaagatagggttgaattttctttgttgatctatgcctgtagaactacataatgaaagttcattgtttatcttgg |
200 |
Q |
| |
|
|||| || ||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
36056247 |
tagaggagaatttggtagtgaaagataaagatagggttgaattttctttgttgatctatgcctgtaaaactacataatgaaagttcattgtttatcttgg |
36056346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 47; Significance: 7e-18; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 1 - 166
Target Start/End: Complemental strand, 20085441 - 20085273
Alignment:
| Q |
1 |
gatttgctttgggatgttcatagttggttttttaaacct---gtttctgggtttgcagtgtttatgtttaggactaggagtggtttggatagtagattat |
97 |
Q |
| |
|
||||||||||||||||||||| |||||| ||||| ||| | |||||| | ||| || || |||||||| || || |||||||||||||||||||| | |
|
|
| T |
20085441 |
gatttgctttgggatgttcatgattggttctttaatcctcaagcttctggttatgctgttttcatgtttagaacaagaagtggtttggatagtagattgt |
20085342 |
T |
 |
| Q |
98 |
ggttagaagataatttagtactgaaagataaagatagggttgaattttctttgttgatctatgcctgta |
166 |
Q |
| |
|
|||||||||| || | |||||||||||| || |||||||| ||||||||||||||||| |||| |
|
|
| T |
20085341 |
ggttagaagagaagcattctcagaaagataaagacagagttgaattctctttgttgatctatgcatgta |
20085273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 58 - 107
Target Start/End: Original strand, 42021658 - 42021707
Alignment:
| Q |
58 |
tttatgtttaggactaggagtggtttggatagtagattatggttagaaga |
107 |
Q |
| |
|
|||||||||||||| |||||||||||| |||||||||||||||| ||||| |
|
|
| T |
42021658 |
tttatgtttaggacaaggagtggtttgaatagtagattatggttggaaga |
42021707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University