View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17763_low_109 (Length: 281)
Name: NF17763_low_109
Description: NF17763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17763_low_109 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 21 - 241
Target Start/End: Complemental strand, 33788144 - 33787925
Alignment:
| Q |
21 |
tcagtaactatatcattatcataaatttaaacatataaactcgtaggaagtgaagcataagcaattggactttggttttttcattaattgcatgtggtca |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
33788144 |
tcagtaactatatcattatcataaatttaaacatataaactcgtaagaagtgaagcataagcaattggactttggttttt-cattaattgcatgtggtca |
33788046 |
T |
 |
| Q |
121 |
gatgttacatattttaggctatgtgtcacgcagaccacactctatctgagatttaaccgacacatgtattttccttgtaaaacggacgaaacatgttttt |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
33788045 |
aatgttacatattttaggctatgtgtcacgcagaccacactctacctgagatttaaccgacacatgtattttccttgtaaaacggacgaaacatgtttct |
33787946 |
T |
 |
| Q |
221 |
gtgctctttgctaatcacttg |
241 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
33787945 |
gtgctctttgctaatcacttg |
33787925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University