View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17763_low_117 (Length: 274)
Name: NF17763_low_117
Description: NF17763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17763_low_117 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 126; Significance: 5e-65; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 113 - 259
Target Start/End: Original strand, 50634772 - 50634914
Alignment:
| Q |
113 |
tcgtcaaaaaagagtgatagtatttaatagattaaagttcaactcgtctaattagcatatgcctcaaggttgatcgaatacttacttacttagtcattga |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
50634772 |
tcgtcaaaaaagagtgatagtatttaatagattaaagttcaactcgtctaattaccatatgcctcaaggttgatcgaa----tacttacttagtcattga |
50634867 |
T |
 |
| Q |
213 |
atagtacaagtattacttatttagcttataaactataatttatttat |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50634868 |
atagtacaagtattacttatttagcttataaactataatttatttat |
50634914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 8 - 114
Target Start/End: Original strand, 50634498 - 50634604
Alignment:
| Q |
8 |
agataattctcatatgcatatagctggtcgatgaaatttggtatgcaagttaaaaatatctcccaaagttaagaactttctatgacatatgtgtcgtggt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
50634498 |
agataattctcatatgcatatagctggtcgatgaaattcgatatgcaagttaaaaatatctcccaaagttaagaactttctatgacatgtgtatcgtggt |
50634597 |
T |
 |
| Q |
108 |
tgttttc |
114 |
Q |
| |
|
||||||| |
|
|
| T |
50634598 |
tgttttc |
50634604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University