View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17763_low_121 (Length: 271)
Name: NF17763_low_121
Description: NF17763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17763_low_121 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 6 - 271
Target Start/End: Original strand, 43314305 - 43314570
Alignment:
| Q |
6 |
actttcttctgccaaacttgtcaaccagaaacattgaaatgacagtagcaacaaggagagctccattggtaataaaagatgagaaaagagctgcattaga |
105 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43314305 |
actttcttctgccaaacttgtcaaccaaaaacattgaaatgacagtagcaacaaggagagctccattggtaataaaagatgagaaaagagctgcattaga |
43314404 |
T |
|
| Q |
106 |
tccaaaccctaaactctggaagatgacaggtgcgtagaagagaatggagttatttcctgttaactgttggaatgctggaatccctaacgcccctattatc |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43314405 |
tccaaaccctaaactctggaagatgacaggtgcatagaagagaatggagttatttcctgttaactgttggaatgctggaatccctaacgcccctattatc |
43314504 |
T |
|
| Q |
206 |
agttgtggcctgtacttcctctttagaagtaccttaaatggactcttcacaggttctgctcgttca |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| || |||| ||||| |
|
|
| T |
43314505 |
agttgtggcctgtacttcctctttagaagtaccttaaatggactcttcacagcttgtgctagttca |
43314570 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University