View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17763_low_130 (Length: 264)
Name: NF17763_low_130
Description: NF17763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17763_low_130 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 17 - 121
Target Start/End: Original strand, 42691213 - 42691317
Alignment:
| Q |
17 |
catacttttcatgtgggagtagtgaaacatcaagcattgtctatgcgaatcattatagttgaaatacattgctctcaaataatttgcaaaggattatatc |
116 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42691213 |
catacttttcatgtgttagtagtgagacatcaagcattgtctatgcgaatcattatagttgaaatacattgctctcaaataatttgcaaaggattatatc |
42691312 |
T |
|
| Q |
117 |
aaccc |
121 |
Q |
| |
|
||||| |
|
|
| T |
42691313 |
aaccc |
42691317 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 165 - 257
Target Start/End: Original strand, 42691361 - 42691457
Alignment:
| Q |
165 |
gtcggtggtttgttgagtcaataata----atccattgatgttaatttgcccatcatcatcattttattactttgcttcgtttgattgcctttgcta |
257 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
42691361 |
gtcggtggtttgttgagtcaataataaataatccattgatgttaatttgcccatcatcatcattttattactttgcttcgtttgattgcttttgcta |
42691457 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University