View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17763_low_132 (Length: 263)
Name: NF17763_low_132
Description: NF17763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17763_low_132 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 18 - 250
Target Start/End: Original strand, 8398352 - 8398571
Alignment:
| Q |
18 |
cattgattctttttgggtagtttagcctaaccactaatcaatgtgtaatttttgggttggttccatttttacccaaacaaggaaacgatgtgttgtatca |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
8398352 |
cattgattctttttgggtagtttagcctaaccactaatcaatgtgtaatttttgggttggttcaatttttacccaaacaaggaaacgatgtgttgtatca |
8398451 |
T |
 |
| Q |
118 |
tatttggactgtctcatatttgaatctattatgagaggttagattgatactcacggttaaacttcagcgatatgaatttacagaattttatgtcgtattc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8398452 |
tatttggactgtctcatatttgaatctattatgagaggttaga-------------ttaaagttcagcgatatgaatttacagaattttatgtcgtattc |
8398538 |
T |
 |
| Q |
218 |
aaattcatttatcggaactttttatcctatgct |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
8398539 |
aaattcatttatcggaactttttatcctatgct |
8398571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University