View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17763_low_133 (Length: 258)
Name: NF17763_low_133
Description: NF17763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17763_low_133 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 20595983 - 20595743
Alignment:
| Q |
1 |
acctcatcatcaaacacaggttcagtcacagtatgttctactctttttcctcttggtcttcccctctttttctttggcttactaccactggccactgcag |
100 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
20595983 |
acctcatcatcaaacacaggttcaatcacagtatgttctactctttttcctcttggtcttcccctctttttctttggcttactaccactagccactgcag |
20595884 |
T |
 |
| Q |
101 |
tcacactaggttctgtctgagttccttcagatgcaacttcctgagtcacattctgatctgcttcaacatctccctgtattgcttcttcattaacaacatt |
200 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20595883 |
tcacactaggttctgtctgagtttcttcagatgcaacttcctgagtcacattctgatctgcttcaacatctccctgtattgcttcttcattaacaacatt |
20595784 |
T |
 |
| Q |
201 |
cccaacattcccctcaccttcaaaaatatcactaactacct |
241 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||||||||| |
|
|
| T |
20595783 |
cccaatattcccctcaccttcaaaaatgtcactaactacct |
20595743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 8696982 - 8696744
Alignment:
| Q |
1 |
acctcatcatcaaacacaggttcagtcacagtatgttctactctttttcctcttggtcttcccctctttttctttggcttactaccactggccactgcag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| || ||||||| ||||||||||||||||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
8696982 |
acctcatcatcaaacacaggttcagtcacaatatattgtactcttgatcctcttggtcttcccctccttttctttggcttactaccactggcctctgcag |
8696883 |
T |
 |
| Q |
101 |
tcacactaggttctgtctgagttccttcagatgcaacttcctgagtcacattctgatctgcttcaacatctccctgtattgcttcttcattaacaacatt |
200 |
Q |
| |
|
|||||||||||||| ||||| |||||| ||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8696882 |
tcacactaggttctatctgaattccttgagatgcagcttcctgagtcacattatgatctgcttcaacatctccctgtattgcttcttcattaacaacatt |
8696783 |
T |
 |
| Q |
201 |
cccaacattcccctcaccttcaaaaatatcactaactac |
239 |
Q |
| |
|
||||||||||| |||| | |||||||| ||||||||||| |
|
|
| T |
8696782 |
cccaacattcctctcaacatcaaaaatgtcactaactac |
8696744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University