View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17763_low_134 (Length: 257)
Name: NF17763_low_134
Description: NF17763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17763_low_134 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 80 - 242
Target Start/End: Complemental strand, 34349858 - 34349696
Alignment:
| Q |
80 |
ctactaatttgaagtttggcaaggaggtaagtactatctaacccatgattgtttcagacagaaattaaactcaggcgtttctgatcaattcgaacttaac |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
34349858 |
ctactaatttgaagtttggcaaggaggtaagtacaatctaacccatgattgtttcagacagaaattaaactcaggcatttctgatcaattcgaacttaag |
34349759 |
T |
 |
| Q |
180 |
tgaagttcattaaccacttgagtgtccaaccaattaggttaactcaaataagtattagtttct |
242 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
34349758 |
tgtagttcattaaccacttgagtgtccaaccaattaggttaactcaaatatgtattagtttct |
34349696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University