View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17763_low_137 (Length: 255)
Name: NF17763_low_137
Description: NF17763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17763_low_137 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 71 - 236
Target Start/End: Original strand, 8459467 - 8459632
Alignment:
| Q |
71 |
tcgttaacgttttgaaaaataaagatatggaagattatttgaagttgagtacaaaagttttgatgtttaacaagatattagctttttctggtccaatact |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8459467 |
tcgttaacgttttgaaaaataaagatatggaagattatttgaagttgagtacaaaagttttgatgtttaacaagatattagctttttctggtccaatact |
8459566 |
T |
 |
| Q |
171 |
aacttgtcttgcagcttttggttctannnnnnngggttctgttaatgcaccttggcctgtgatgtt |
236 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
8459567 |
aacttgtcttgcagcttttggttctatttttttgggttctgttaatgcaccttggcctgtgatgtt |
8459632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University