View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17763_low_140 (Length: 254)
Name: NF17763_low_140
Description: NF17763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17763_low_140 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 76 - 239
Target Start/End: Original strand, 1890474 - 1890637
Alignment:
| Q |
76 |
agcaaagtacaatgggagtatataaacagtttcttaaataatataccaacttttaatacaaccaaccaacttttatctttcatttcagtttatggtccaa |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1890474 |
agcaaagtacaatgggagtatataaacagtttcttaaataatataccaacttttaatacaaccaaccaacttttatctttcatttcagtttatggtccaa |
1890573 |
T |
|
| Q |
176 |
acctcatcatgaaaaacatctcacagaaattctgaacttcagcagaatttgtgattgttgtgta |
239 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1890574 |
acctcatcatgaaaaacatctcatagaaattctgaacttcagcagaatttgtgattgttgtgta |
1890637 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University