View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17763_low_148 (Length: 247)
Name: NF17763_low_148
Description: NF17763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17763_low_148 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 19 - 230
Target Start/End: Original strand, 483686 - 483897
Alignment:
| Q |
19 |
ggtagccgccttaatggttgctaaagtcatgaacaacagttgatcagaactaatcaactcaccttcttgtgtgattgctacatttttggggctagacaat |
118 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
483686 |
ggtacccgccttaatggttgctaaagtcatgaacaacagttgatcagaactaatcaactcaccttcttgtgtgattgctacatttttggggctagacaat |
483785 |
T |
 |
| Q |
119 |
tcttgaaatagcatcctttcgcttctttcttcgtctgtttcattttgttattggaagacacagttatagaaatgaagtaaaagagaactaagactagtta |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
483786 |
tcttgaaatagcatcctttcgcttctttcttcgtctgtttcattttgttattggaagacacagttatagaaatgaagtaaaagagaactaagactagtta |
483885 |
T |
 |
| Q |
219 |
gttatattagtt |
230 |
Q |
| |
|
|||||||||||| |
|
|
| T |
483886 |
gttatattagtt |
483897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University