View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17763_low_159 (Length: 234)
Name: NF17763_low_159
Description: NF17763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17763_low_159 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 44 - 201
Target Start/End: Original strand, 7822137 - 7822302
Alignment:
| Q |
44 |
ggttcttctgatattatgcttgttgagttgtttacaa------gttaccacggt--atgatattattcaagaatatgggtatcaatgagtttgtttgcta |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7822137 |
ggttcttctgatattatgcttgttgagttgtttacaattacaagttaccacggtgtatgatattattcaagaatatgggtatcaatgagtttgtttgcta |
7822236 |
T |
|
| Q |
136 |
ttctgatttacttctttgcatcaatctatcaactgtcccattgtcaagtaccaatatcacgtcaaa |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| |||||||||| |||||||||| |
|
|
| T |
7822237 |
ttctgatttacttctttgcatcaatctatcaactgtcccgttgtgaagtaccaatgtcacgtcaaa |
7822302 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University