View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17763_low_160 (Length: 234)
Name: NF17763_low_160
Description: NF17763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17763_low_160 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 1 - 188
Target Start/End: Complemental strand, 47014665 - 47014478
Alignment:
| Q |
1 |
gtttggtgttaaattaacctccgtcaatgaaacgttagttttggagggaggttcgtgtcatttgttaaacagttaagggaggtgattgtttattttaaaa |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47014665 |
gtttggtcttaaattaacctccgtcaatgacacgttagttttggagggaggttcgtgtcatttgttaaacagttaagggaggtgattgtttattttaaaa |
47014566 |
T |
 |
| Q |
101 |
ttagacgggatgtttgtgtcgtttaaataggactttagtggatggaaatgtaatattccctaattctataccgtttactcgaatctaa |
188 |
Q |
| |
|
|||||||||||||||||||| |||||| |||||||||| ||| | ||||||||||||||||||| |||||| ||||||| ||||||| |
|
|
| T |
47014565 |
ttagacgggatgtttgtgtcatttaaagaggactttaggggaggtcaatgtaatattccctaattttataccttttactctaatctaa |
47014478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 87 - 119
Target Start/End: Original strand, 34597657 - 34597689
Alignment:
| Q |
87 |
tgtttattttaaaattagacgggatgtttgtgt |
119 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |
|
|
| T |
34597657 |
tgtttattttaaaattagaggggatgtttgtgt |
34597689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University