View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17763_low_165 (Length: 225)
Name: NF17763_low_165
Description: NF17763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17763_low_165 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 18 - 210
Target Start/End: Complemental strand, 42570471 - 42570274
Alignment:
| Q |
18 |
atacttagaaatttcatgggccaatcagcccagcccattcagtagtccaccctaaacccattttcctttctctactct-----gtcagtgaacgacaaat |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
42570471 |
atacttagaaatttcatgggccaatcagcccagcccattcagtagtccaccctaaacccattttcctttctctactctactctgtcagtgaacaacaaat |
42570372 |
T |
|
| Q |
113 |
gaagtgaagaagacgaacacaattcagagcttaacttaggtaatgtcatttataatctttcaaatcctaattattactatgaaatgaaatttcttgat |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42570371 |
gaagtgaagaagacgaacacaattcagagcttaacttaggtaatgtcatttataatctttcaaatcctaattattactatgaaatgaaatttcttgat |
42570274 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University