View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17763_low_174 (Length: 211)
Name: NF17763_low_174
Description: NF17763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17763_low_174 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 9 - 194
Target Start/End: Original strand, 20712420 - 20712605
Alignment:
| Q |
9 |
ggagcagagatgattaaagttactgataagtgccaactatgggtaacatatgcattattattgataatataggtgaattagtcttgtgtgttttgaattt |
108 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20712420 |
ggagtagagatgattaaagttactgataagtgccaactatgggtaacataagcattattattgataatataggtgaattagtcttgtgtgttttgaattt |
20712519 |
T |
|
| Q |
109 |
gataggtcactttcacatgctattatttttcaaatttcaccatgaagcattaatgcaaatgagataatgcccccttatccgaaagc |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
20712520 |
gataggtcactttcacatgctattatttttcaaatttcaccatgaagcattaatgcaaatgagataatgcccccttagccgaaagc |
20712605 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University