View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17763_low_175 (Length: 209)
Name: NF17763_low_175
Description: NF17763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17763_low_175 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 144; Significance: 7e-76; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 1 - 144
Target Start/End: Complemental strand, 2265137 - 2264994
Alignment:
| Q |
1 |
atagagagattctggattatgagacacactgatgctttttctgccaaaagaaagaagtgaacataaagcaaattaaattaagactctttattttgtttgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2265137 |
atagagagattctggattatgagacacactgatgctttttctgccaaaagaaagaagtgaacataaagcaaattaaattaagactctttattttgtttgt |
2265038 |
T |
 |
| Q |
101 |
tcaattatatctctctcctaggcataattattctagcatataaa |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2265037 |
tcaattatatctctctcctaggcataattattctagcatataaa |
2264994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 160 - 195
Target Start/End: Complemental strand, 2264997 - 2264962
Alignment:
| Q |
160 |
taaagaattatttgtattgcttctcgttgaaggttt |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
2264997 |
taaagaattatttgtattgcttctcgttgaaggttt |
2264962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University