View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17763_low_54 (Length: 405)
Name: NF17763_low_54
Description: NF17763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17763_low_54 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 388; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 388; E-Value: 0
Query Start/End: Original strand, 1 - 400
Target Start/End: Original strand, 7544179 - 7544578
Alignment:
| Q |
1 |
caccgtgactcatcatatgtgcctttgtcacgccattcactatctgttttctcatgatctagaagatttggcggcttgaccagaggcctcttcttcgcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7544179 |
caccgtgactcatcatatgtgcctttgtcacgccattcactatctgttttctcatgatctagaagatttggcggcttgaccagaggcctcttcttcgcaa |
7544278 |
T |
 |
| Q |
101 |
ctctttattaggattcagaaaagaaacattaagttgctggaaactgtcaaaatgtttaccgactttgtggagagaattttactcttcttataatttagac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7544279 |
ctctttattaggattcagaaaagaaacattaagttgctggaaactgtcaaaatgtttaccgactttgtggagagaattttactcttcttataatttagac |
7544378 |
T |
 |
| Q |
201 |
ttggacaactgattagccaagattaacacttcttttgcgcaaagtgcaaaatcttcaagtaaatacatatgtgagcatatttctgagatacacgccttta |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7544379 |
ttggacaactgattagccaagattaacacttcttttgcgcaaagtgcaaaatcttcaagtaaatacatatgtgagcatatttctgagatacacgccttta |
7544478 |
T |
 |
| Q |
301 |
agaagtactataagctaaaatggcaccttcgaaactccacttatatgattcgacggatggatgaggttttagttgatgtcacttctattcctatgcttct |
400 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
7544479 |
agaagtactttaagttaaaatggcaccttcgaaactccacttatatgattcgacggatggatgaggttttagttgatgtcacttctattcctgtgcttct |
7544578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University