View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17763_low_68 (Length: 371)
Name: NF17763_low_68
Description: NF17763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17763_low_68 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 291; Significance: 1e-163; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 291; E-Value: 1e-163
Query Start/End: Original strand, 14 - 356
Target Start/End: Complemental strand, 44488296 - 44487943
Alignment:
| Q |
14 |
ttctaatagagttacatggccagggtaccatgtgattaatgctacagatgcttcaaattttacggttgataattttctgcaggggaatgtttggttgcct |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
44488296 |
ttctaatagagttacatggccagggtaccatgtgattaatgctacagatgcttcaaattttacggttgacaattttctgcaggggaatgtttggttgcct |
44488197 |
T |
 |
| Q |
114 |
caaatgggagttccttatattcgtgaacttacaacttttaattagagaacacaagaggaacgatgaataaaggactacata-----------ttgatgct |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
44488196 |
caaatgggagttccttatattcgtgaacttacaacttttaattagagaacacaagaggaacgatgaataaaggactacatattgaggattaattgatgct |
44488097 |
T |
 |
| Q |
203 |
gattgaagaccaaaattatttgatatatttattctttgctgttgtttttaatatacttcaaaagtttttcaaaaggaagagctgcaggttttatttggtg |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44488096 |
gattgaagaccaaaattatttgatatatttattctttgctgttgtttttaatatacttcaaaagtttttcaaaaggaagagctgcaggttttatttggtg |
44487997 |
T |
 |
| Q |
303 |
ggtgttctgcttcctttgctacgcattgtannnnnnncttttgtatgattaatg |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
44487996 |
ggtgttctgcttcctttgctacgcattgtatttttttcttttgtatgattaatg |
44487943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University