View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17764_high_11 (Length: 219)
Name: NF17764_high_11
Description: NF17764
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17764_high_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 1 - 99
Target Start/End: Complemental strand, 33174869 - 33174771
Alignment:
| Q |
1 |
ggaagacgactactcgatcttgttccacaactaaaagagttgttagccgccaatgattgagagctcgaattgggagccctagttctccaaatttaggga |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33174869 |
ggaagacgactactcgatcttgttccacaactaaaagagttgttagccgccaatgattgagagctcgaattgggagccctagttctccaaatttaggga |
33174771 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University