View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17764_low_11 (Length: 268)
Name: NF17764_low_11
Description: NF17764
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17764_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 134; Significance: 8e-70; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 134; E-Value: 8e-70
Query Start/End: Original strand, 16 - 149
Target Start/End: Complemental strand, 37532427 - 37532294
Alignment:
| Q |
16 |
caatatctacatgttggtgaagataaaaaaggagctcgactccaagctttagaaccgaagcctgctggacgcgggcacagtcaacacctggtagatcctt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37532427 |
caatatctacatgttggtgaagataaaaaaggagctcgactccaagctttagaaccgaagcctgctggacgcgggcacagtcaacacctggtagatcctt |
37532328 |
T |
|
| Q |
116 |
tgctttcgaaattcaaattctcaccatgatgaaa |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
37532327 |
tgctttcgaaattcaaattctcaccatgatgaaa |
37532294 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 206 - 253
Target Start/End: Complemental strand, 37532237 - 37532190
Alignment:
| Q |
206 |
aatcctagattggtactgaagttcttggcaaaattgatggagcctttg |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37532237 |
aatcctagattggtactgaagttcttggcaaaattgatggagcctttg |
37532190 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 208 - 253
Target Start/End: Complemental strand, 26897121 - 26897076
Alignment:
| Q |
208 |
tcctagattggtactgaagttcttggcaaaattgatggagcctttg |
253 |
Q |
| |
|
|||||||||||| ||||||||| |||||| ||||||||||||||| |
|
|
| T |
26897121 |
tcctagattggtgctgaagttcacggcaaagttgatggagcctttg |
26897076 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University