View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17764_low_9 (Length: 320)
Name: NF17764_low_9
Description: NF17764
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17764_low_9 |
 |  |
|
| [»] scaffold0054 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0054 (Bit Score: 61; Significance: 3e-26; HSPs: 2)
Name: scaffold0054
Description:
Target: scaffold0054; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 38 - 179
Target Start/End: Complemental strand, 16905 - 16765
Alignment:
| Q |
38 |
acatacggtgtgcaaaatacagatcaatacaatcaatgtcatcatccaattcaactcaaaacttttgttcaagtannnnnnngaagaatataaggtctaa |
137 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||||||||||| ||||||||||||||| ||||||||||||||| |||| | | | ||||| |
|
|
| T |
16905 |
acatacggtgtgcagaatacaaatcaatacaatcaatgtcataatccaattcaactcataacttttgttcaagttttttttttaagagt-ttatatctaa |
16807 |
T |
 |
| Q |
138 |
tgagagcatatacattattctaacaaattctcttagcacttg |
179 |
Q |
| |
|
||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
16806 |
tgagagcatatgcattattcacacaaattctcttagcacttg |
16765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0054; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 240 - 301
Target Start/End: Complemental strand, 16704 - 16643
Alignment:
| Q |
240 |
gttgatattcactttccccttattttcaaagacaatattcctattttagtttctggtgagaa |
301 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16704 |
gttgatagtcactttccccttattttcaaagacaatattcctattttagtttctggtgagaa |
16643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University