View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17765_low_13 (Length: 257)
Name: NF17765_low_13
Description: NF17765
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17765_low_13 |
 | |
|
| [»] scaffold0265 (1 HSPs) |
| | |
|
Alignment Details
Target: chr8 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 8 - 240
Target Start/End: Complemental strand, 39522877 - 39522645
Alignment:
| Q |
8 |
tgagatgaagagggaaactttgcctgagaaaatggctaggaagagaagacgcttgaaacagattcgactaagttttgtgaaaaagcccaaaaagagcaga |
107 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39522877 |
tgagaagaagagggaaactttgcctgagaaaatggctaggaagagaagacgcttgaaacagattcgactaagttttgtgaaaaagcccaaaaagagcaga |
39522778 |
T |
|
| Q |
108 |
ttcggctgagttttgtgaagaagcccaaatgaaggatgggttgatgatctcagtttttcacttagaaatagacttatctgtttgaatattgttttcattt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39522777 |
ttcggctgagttttgtgaagaagcccaaatgaaggatgggttgatgatctcagtttttcacttagaaatagacttatctgtttgaatattgttttcattt |
39522678 |
T |
|
| Q |
208 |
tgtcatgattagttttactcttgccttgtgctt |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
39522677 |
tgtcatgattagttttactcttgccttgtgctt |
39522645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0265 (Bit Score: 62; Significance: 7e-27; HSPs: 1)
Name: scaffold0265
Description:
Target: scaffold0265; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 18 - 83
Target Start/End: Original strand, 5375 - 5440
Alignment:
| Q |
18 |
agggaaactttgcctgagaaaatggctaggaagagaagacgcttgaaacagattcgactaagtttt |
83 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
5375 |
agggaaactttgcctgagaaaatggctaggaagagaagacgcttgaaacagattcgactgagtttt |
5440 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 62; Significance: 7e-27; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 18 - 83
Target Start/End: Complemental strand, 21827409 - 21827344
Alignment:
| Q |
18 |
agggaaactttgcctgagaaaatggctaggaagagaagacgcttgaaacagattcgactaagtttt |
83 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
21827409 |
agggaaactttgcctgagaaaatggctaggaagagaagacgcttgaaacagattcgactgagtttt |
21827344 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University