View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17765_low_14 (Length: 252)
Name: NF17765_low_14
Description: NF17765
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17765_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 12 - 237
Target Start/End: Original strand, 17231593 - 17231820
Alignment:
| Q |
12 |
tatacttttttgttaaacaaacaggttgagtaaggattttttacaagcctagtgtggctttggaatggatcgtggagtttaagttca-tcggattatttt |
110 |
Q |
| |
|
||||||||| |||||| || ||| ||| ||||| || ||||||||||||||| |||||||||||||||| ||||||||||||||| | |||||||||| |
|
|
| T |
17231593 |
tatacttttatgttaatcaggcagagtgattaaggcttctttacaagcctagtgcggctttggaatggatcatggagtttaagttcaattggattatttt |
17231692 |
T |
 |
| Q |
111 |
-tcgatggactccaagttggttgtcgacaaatttaatcgacacctctcaatataacacaaatgtaaacaccattcttgctagatgtaggtttctgatgag |
209 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||| |
|
|
| T |
17231693 |
ttcgatggactccaagttagttgtcgacaaatttaatcgacacctctcaatataacacaaatgtaaacaccattcttgctagatgtaggtttttaatgag |
17231792 |
T |
 |
| Q |
210 |
tttttgtacaactctcatgtgaagtttt |
237 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
17231793 |
tttttgtacaactctcatgtgaagtttt |
17231820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 107 - 197
Target Start/End: Original strand, 30612340 - 30612429
Alignment:
| Q |
107 |
tttttcgatggactccaagttggttgtcgacaaatttaatcgacacctctcaatataacacaaatgtaaacaccattcttgctagatgtag |
197 |
Q |
| |
|
|||| ||||||||||||||||||| || ||| ||||||||||||| ||||||| ||||||| || ||| | | |||||||||| |||||| |
|
|
| T |
30612340 |
ttttccgatggactccaagttggtcgtagaccaatttaatcgaca-ctctcaagataacacgaaagtaggcgctattcttgctaaatgtag |
30612429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University