View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17765_low_17 (Length: 249)
Name: NF17765_low_17
Description: NF17765
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17765_low_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 32 - 100
Target Start/End: Complemental strand, 44798601 - 44798533
Alignment:
| Q |
32 |
gtgttgttgttttgtgagagtaatggcagtgtctgtgtaggaagcatcaccaaagagtgtgatgttttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44798601 |
gtgttgttgttttgtgagagtaatggaagtgtctgtgtaggaagcatcaccaaagagtgtgatgttttg |
44798533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 171 - 233
Target Start/End: Complemental strand, 44798462 - 44798400
Alignment:
| Q |
171 |
ctgagcattgtgtagaattaagagtgatgaagttttcaagaatttgttttcatggtaaagatg |
233 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
44798462 |
ctgagcattgtgtagaattaagagtggtgaagttttcaagaatttgttttcatggtaaagatg |
44798400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University