View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17765_low_21 (Length: 241)
Name: NF17765_low_21
Description: NF17765
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17765_low_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 26 - 228
Target Start/End: Complemental strand, 37866303 - 37866101
Alignment:
| Q |
26 |
cagggtactctttctcagaaccacctaactgcatctcctgtaactctgtcgatttcaaagactgtcaaaagttcaatgaattttaagaagggttgttgtg |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
37866303 |
cagggtactctttctcagaaccacctaacttcatctcctgtaactctgtcgatttcaaagactgtcaaaagttcaatgaatcttaagaagggttgttgtg |
37866204 |
T |
 |
| Q |
126 |
ttcaaagtcgcggcggatttcaattgtacttggtgcttgctgatcaactgagattgatgaaaggaaaattgatgaaaaaacaataaataatcaaattatt |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37866203 |
ttcaaagtcgcggcggatttcaattgtacttggtggttgctggttaactgagattgatgaaaggaaaattgatgaaaaaacaataaataatcaaattatt |
37866104 |
T |
 |
| Q |
226 |
ctt |
228 |
Q |
| |
|
||| |
|
|
| T |
37866103 |
ctt |
37866101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University